![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-495 |
||||||||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0004639 (change log) | |||||||||||||||||||||||||||||||||||||||||||||||||
Symbol | MGI:Mir495 | |||||||||||||||||||||||||||||||||||||||||||||||||
Description | Mus musculus miR-495 stem-loop | |||||||||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000110; mir-329 | |||||||||||||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
24 open access papers mention mmu-mir-495 | |||||||||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
a u - --a u uuu 5' aagaagu gc ccauguu uuu ucgc u ||||||| || ||||||| ||| |||| 3' uucuuca cg gguacaa aag agug a - - u aca c uuu |
|||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-495-5p |
|
Accession | MIMAT0017249 |
Previous IDs | mmu-miR-495* |
Sequence |
4 - gaaguugcccauguuauuuuucg - 26 |
Deep sequencing | 710 reads, 40 experiments |
Evidence | experimental; Illumina [4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-495-3p |
|
Accession | MIMAT0003456 |
Previous IDs | mmu-miR-495 |
Sequence |
42 - aaacaaacauggugcacuucuu - 63 |
Deep sequencing | 24610 reads, 82 experiments |
Evidence | experimental; MPSS [1], cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|