Stem-loop sequence mmu-mir-146b

AccessionMI0004665 (change log)
Symbol MGI:Mir146b
DescriptionMus musculus miR-146b stem-loop
Gene family MIPF0000103; mir-146
Literature search

188 open access papers mention mmu-mir-146b
(1076 sentences)

Stem-loop
   gacugagagaacuu    -  -  u   u  g        a    a    c   ga  u 
5'               uggc ca cc ggc cu agaacuga uucc uagg ugu  gc c
                 |||| || || ||| || |||||||| |||| |||| |||  ||  
3'               aucg gu gg ccg gg ucuugacu aggg aucc gca  cg u
   -------cuaccau    u  c  c   u  -        c    -    c   ga  a 
Get sequence
Deep sequencing
1218868 reads, 2.19e+03 reads per million, 113 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 46342762-46342870 [+]
sense
OTTMUST00000082701 ; Tmem180-003; intron 1
ENSMUST00000128041 ; Tmem180-003; intron 1
Database links

Mature sequence mmu-miR-146b-5p

Accession MIMAT0003475
Previous IDsmmu-miR-146b
Sequence

29 - 

ugagaacugaauuccauaggcu

 - 50

Get sequence
Deep sequencing1217760 reads, 111 experiments
Evidence experimental; MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-146b-3p

Accession MIMAT0004826
Previous IDsmmu-miR-146b*
Sequence

67 - 

gcccuagggacucaguucuggu

 - 88

Get sequence
Deep sequencing1085 reads, 61 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).