![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-669a-3 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0004668 (change log) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Symbol | MGI:Mir669a-3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | Mus musculus miR-669a-3 stem-loop | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000316; mir-467 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
15 open access papers mention mmu-mir-669a-3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
uuccucca -- a g gu c c c au 5' ugua ugugc ugugu uaua ugugugug auguu augu uau u |||| ||||| ||||| |||| |||||||| ||||| |||| ||| 3' acau acacg acgca auau acacacac uacaa uaca aua u ----agac ac a a gu a - u ag |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-669a-5p |
|
Accession | MIMAT0003477 |
Previous IDs | mmu-miR-669a |
Sequence |
28 - aguugugugugcauguucaugucu - 51 |
Deep sequencing | 946140 reads, 103 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-669a-3-3p |
|
Accession | MIMAT0017251 |
Sequence |
64 - acauaacauacacacacauguau - 86 |
Deep sequencing | 18743 reads, 100 experiments |
Evidence | experimental; Illumina [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
3 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|