![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-297b |
||||||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0004674 (change log) | |||||||||||||||||||||||||||||||||||||||||||||||
Symbol | MGI:Mir297b | |||||||||||||||||||||||||||||||||||||||||||||||
Description | Mus musculus miR-297b stem-loop | |||||||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000204; mir-297 | |||||||||||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
10 open access papers mention mmu-mir-297b | |||||||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
gc --a g c aac a a u 5' ucuauuu uugugugu uauguaugu ug aug augugu uaug aua a ||||||| |||||||| ||||||||| || ||| |||||| |||| ||| 3' agguaaa gacacaca auacguaca ac uac uacaca auac uau c -a aac a a cca c a a |
|||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-297b-5p |
|
Accession | MIMAT0003480 |
Previous IDs | mmu-miR-297b |
Sequence |
20 - auguaugugugcaugaacaugu - 41 |
Deep sequencing | 4464 reads, 80 experiments |
Evidence | experimental; MPSS [1], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-297b-3p |
|
Accession | MIMAT0004827 |
Sequence |
57 - uauacauacacacauacccaua - 78 |
Deep sequencing | 6900 reads, 93 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|