Stem-loop sequence mmu-mir-697

AccessionMI0004681 (change log)
Symbol MGI:Mir697
DescriptionMus musculus miR-697 stem-loop
Literature search

3 open access papers mention mmu-mir-697
(3 sentences)

Stem-loop
   gagu      guguccugg   u       g     u u   a    --  ua    -a au 
5'     ggggau         aug uggucuu acagg c cag ggug  ac  ccac  c  u
       ||||||         ||| ||||||| ||||| | ||| ||||  ||  ||||  |   
3'     ccucug         uac gucagag ugucc g guc cuac  ug  ggug  g  g
   ----      --------a   u       g     u -   -    aa  gc    gg aa 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 124731694-124731802 [+]
sense
OTTMUST00000020731 ; Sf3a3-001; intron 16
ENSMUST00000030734 ; Sf3a3-001; intron 16
Database links

Mature sequence mmu-miR-697

Accession MIMAT0003487
Sequence

75 - 

aacauccugguccuguggaga

 - 95

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; MPSS [1]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).