Stem-loop sequence mmu-mir-705

AccessionMI0004689 (change log)
Symbol MGI:Mir705
DescriptionMus musculus miR-705 stem-loop
Literature search

12 open access papers mention mmu-mir-705
(40 sentences)

Stem-loop
   augucccagua  ggu           u    -a   a     uga 
5'            gu   gggaggugggg gggc  cag gggaa   c
              ||   ||||||||||| ||||  ||| |||||    
3'            ca   cccuccauccc ccug  guc cucuu   u
   ---------ua  -au           u    ac   -     ucu 
Get sequence
Deep sequencing
30 reads, 5.26 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 85336292-85336373 [-]
sense
ENSMUST00000060837 ; Rab11fip5-201; 3'UTR (exon 5)
Database links

Mature sequence mmu-miR-705

Accession MIMAT0003495
Sequence

14 - 

ggugggagguggggugggca

 - 33

Get sequence
Deep sequencing16 reads, 11 experiments
Evidence experimental; MPSS [1]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).