Stem-loop sequence hsv1-mir-H1

AccessionMI0004730 (change log)
DescriptionHerpes Simplex Virus 1 miR-H1 stem-loop
Gene family MIPF0000738; mir-H1
Stem-loop 
     a    aa      a       ac   aa   ga  ucc  a 
5' cg gggg  cggggg uggaagg  ggg  gug  ag   ug u
   || ||||  |||||| |||||||  |||  |||  ||   || a
3' gc cccc  gccucc accuucc  ccc  cac  uc   ac c
     -    cg      c       gu   cc   -a  -cu  c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv1-miR-H1-5p

Accession MIMAT0003744
Previous IDshsv1-miR-H1
Sequence

15 -  

gauggaaggacgggaagugga

 - 35

Get sequence
Evidence experimental; Northern [1], Illumina [2]

Mature sequence hsv1-miR-H1-3p

Accession MIMAT0015220
Previous IDshsv1-miR-H1*
Sequence

53 -  

uacaccccccugccuuccacccu

 - 75

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:16699030 "Prediction and identification of herpes simplex virus 1-encoded microRNAs" Cui C, Griffiths A, Li G, Silva LM, Kramer MF, Gaasterland T, Wang XJ, Coen DM J Virol. 80:5499-5508(2006).
2
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).