![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsv1-mir-H1 |
|
Accession | MI0004730 (change log) |
Description | Herpes Simplex Virus 1 miR-H1 stem-loop |
Gene family | MIPF0000738; mir-H1 |
Stem-loop |
a aa a ac aa ga ucc a 5' cg gggg cggggg uggaagg ggg gug ag ug u || |||| |||||| ||||||| ||| ||| || || a 3' gc cccc gccucc accuucc ccc cac uc ac c - cg c gu cc -a -cu c |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence hsv1-miR-H1-5p |
|
Accession | MIMAT0003744 |
Previous IDs | hsv1-miR-H1 |
Sequence |
15 - gauggaaggacgggaagugga - 35 |
Evidence | experimental; Northern [1], Illumina [2] |
Mature sequence hsv1-miR-H1-3p |
|
Accession | MIMAT0015220 |
Previous IDs | hsv1-miR-H1* |
Sequence |
53 - uacaccccccugccuuccacccu - 75 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:16699030
"Prediction and identification of herpes simplex virus 1-encoded microRNAs"
J Virol. 80:5499-5508(2006).
|
2 |
PMID:20181707
"Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2"
J Virol. 84:4659-4672(2010).
|