Stem-loop sequence bta-mir-151

Accession

MI0004738 (change log)

Description

Bos taurus miR-151 stem-loop

Gene family

MIPF0000057; mir-28

Literature search

11 open access papers mention bta-mir-151
(26 sentences)

Stem-loop

       c            ca          c ucu 
5' ccug ccucgaggagcu  cagucuagua g   c
   |||| ||||||||||||  |||||||||| |    
3' ggac ggaguuccucga  gucagaucau c   a
       a            -a          c ccu 

Deep sequencing

368044 reads, 4e+03 reads per million, 77 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr14: 4090080-4090148 [+]
• Overlapping transcripts:

  sense

  ENSBTAT00000042244 ; bta-mir-151-201; exon 1

  ENSBTAT00000012605 ; PTK2-202; intron 24

  ENSBTAT00000064860 ; PTK2-201; intron 26

Database links

• EntrezGene:MIR151
• RNAcentral:URS000075E31C_9913
• miRBase Tracker:MI0004738

Mature sequence bta-miR-151-5p

• Accession: MIMAT0003523
• Previous IDs: bta-miR-151*
• Sequence: 8 - ucgaggagcucacagucuagu - 28
• Deep sequencing: 178151 reads, 77 experiments
• Evidence: experimental; cloned [1]
• Predicted targets:
  • TargetScanVert:bta-miR-151-5p

Mature sequence bta-miR-151-3p

• Accession: MIMAT0003524
• Previous IDs: bta-miR-151
• Sequence: 44 - cuagacugaagcuccuugagg - 64
• Deep sequencing: 189893 reads, 77 experiments
• Evidence: by similarity; MI0000173
• Predicted targets:
  • TargetScanVert:bta-miR-151-3p

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).