Stem-loop sequence bta-mir-16b

Accession

MI0004739 (change log)

Previous IDs

bta-mir-16

Description

Bos taurus miR-16b stem-loop

Gene family

MIPF0000006; mir-15

Literature search

33 open access papers mention bta-mir-16b
(72 sentences)

Stem-loop

   caua     uc     u         ua        c  --    aa 
5'     cuugu  cgcug agcagcacg  aauauugg gu  agua  a
       |||||  ||||| |||||||||  |||||||| ||  ||||  u
3'     ggaca  gcgau ucgucgugu  uuauaacc ca  uuau  a
   --ag     gu     u         ua        a  aa    aa 

Deep sequencing

183393 reads, 2.13e+03 reads per million, 76 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr1: 108321598-108321690 [-]
• Overlapping transcripts:

  sense

  ENSBTAT00000007705 ; SMC4-201; intron 5

  ENSBTAT00000052946 ; SMC4-202; intron 5

Clustered miRNAs

< 10kb from bta-mir-16b

• bta-mir-15b: chr1: 108321741-108321838 [-]
• bta-mir-16b: chr1: 108321598-108321690 [-]

Database links

• EntrezGene:MIR16B
• RNAcentral:URS000075D0CB_9913
• miRBase Tracker:MI0004739

Mature sequence bta-miR-16b

• Accession: MIMAT0003525
• Previous IDs: bta-miR-16
• Sequence: 17 - uagcagcacguaaauauuggc - 37
• Deep sequencing: 183034 reads, 76 experiments
• Evidence: experimental; cloned [1-3]
• Predicted targets:
  • TargetScanVert:bta-miR-16b

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3. PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).