![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-18a |
||||||||||||||
Accession | MI0004740 (change log) | |||||||||||||
Description | Bos taurus miR-18a stem-loop | |||||||||||||
Gene family | MIPF0000001; mir-17 | |||||||||||||
Literature search |
![]()
7 open access papers mention bta-mir-18a | |||||||||||||
Stem-loop |
u cu u uc u a - aa u 5' guu aagg gca uag gcag uag ug g a ||| |||| ||| ||| |||| ||| || | g 3' cgg uucc cgu auc cguc auc ac u a a uc u ga c - u ga u |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence bta-miR-18a |
|
Accession | MIMAT0003526 |
Sequence |
6 - uaaggugcaucuagugcagaua - 27 |
Deep sequencing | 3974 reads, 67 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|