![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-21 |
|||||
Accession | MI0004742 (change log) | ||||
Description | Bos taurus miR-21 stem-loop | ||||
Gene family | MIPF0000060; mir-21 | ||||
Literature search |
![]()
60 open access papers mention bta-mir-21 | ||||
Stem-loop |
u gu a a a u a 5' gucgg agcuuauc gacug uguug cugu g a ||||| |||||||| ||||| ||||| |||| | u 3' caguc ucggguag cugac acaac ggua c c a ug - g - - u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-21-5p |
|
Accession | MIMAT0003528 |
Previous IDs | bta-miR-21 |
Sequence |
8 - uagcuuaucagacugauguugacu - 31 |
Deep sequencing | 2121395 reads, 78 experiments |
Evidence | experimental; cloned [1-3] |
Predicted targets |
|
Mature sequence bta-miR-21-3p |
|
Accession | MIMAT0003745 |
Previous IDs | bta-miR-21* |
Sequence |
47 - aacagcagucgaugggcugucu - 68 |
Deep sequencing | 27997 reads, 73 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|
3 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|