Stem-loop sequence bta-mir-21

AccessionMI0004742 (change log)
DescriptionBos taurus miR-21 stem-loop
Gene family MIPF0000060; mir-21
Literature search

60 open access papers mention bta-mir-21
(320 sentences)

Stem-loop 
   u     gu        a     a     a    u a 
5'  gucgg  agcuuauc gacug uguug cugu g a
    |||||  |||||||| ||||| ||||| |||| | u
3'  caguc  ucggguag cugac acaac ggua c c
   a     ug        -     g     -    - u
Get sequence
Deep sequencing
2149398 reads, 2.05e+04 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 11138471-11138542 [+]
sense
ENSBTAT00000042276 ; bta-mir-21-201; exon 1
Database links

Mature sequence bta-miR-21-5p

Accession MIMAT0003528
Previous IDsbta-miR-21
Sequence

8 -  

uagcuuaucagacugauguugacu

 - 31

Get sequence
Deep sequencing2121395 reads, 78 experiments
Evidence experimental; cloned [1-3]
Predicted targets

Mature sequence bta-miR-21-3p

Accession MIMAT0003745
Previous IDsbta-miR-21*
Sequence

47 -  

aacagcagucgaugggcugucu

 - 68

Get sequence
Deep sequencing27997 reads, 73 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3
PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).