Stem-loop sequence bta-mir-30d

Accession

MI0004747 (change log)

Description

Bos taurus miR-30d stem-loop

Gene family

MIPF0000005; mir-30

Literature search

27 open access papers mention bta-mir-30d
(125 sentences)

Stem-loop

   guu  u         ccc           guacca 
5'    gu guaaacauc   gacuggaagcu      c
      || |||||||||   |||||||||||       
3'    cg cguuuguag   cugacuuucga      a
   cau  u         --a           aucgac 

Deep sequencing

1012581 reads, 3.44e+04 reads per million, 78 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr14: 8141427-8141496 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from bta-mir-30d

• bta-mir-30d: chr14: 8141427-8141496 [+]
• bta-mir-30b: chr14: 8145856-8145943 [+]

Database links

• EntrezGene:MIR30D
• RNAcentral:URS000075E161_9913
• miRBase Tracker:MI0004747

Mature sequence bta-miR-30d

• Accession: MIMAT0003533
• Sequence: 6 - uguaaacauccccgacuggaagcu - 29
• Deep sequencing: 995246 reads, 78 experiments
• Evidence: experimental; cloned [1-2]
• Predicted targets:
  • TargetScanVert:bta-miR-30d

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).