![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-30d |
||||||
Accession | MI0004747 (change log) | |||||
Description | Bos taurus miR-30d stem-loop | |||||
Gene family | MIPF0000005; mir-30 | |||||
Literature search |
![]()
27 open access papers mention bta-mir-30d | |||||
Stem-loop |
guu u ccc guacca 5' gu guaaacauc gacuggaagcu c || ||||||||| ||||||||||| 3' cg cguuuguag cugacuuucga a cau u --a aucgac |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence bta-miR-30d |
|
Accession | MIMAT0003533 |
Sequence |
6 - uguaaacauccccgacuggaagcu - 29 |
Deep sequencing | 995246 reads, 78 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|