Stem-loop sequence bta-mir-125a

AccessionMI0004752 (change log)
DescriptionBos taurus miR-125a stem-loop
Gene family MIPF0000033; mir-10
Literature search

13 open access papers mention bta-mir-125a
(19 sentences)

Stem-loop 
   u     c u   c uc  ug   c    ua        ----  a 
5'  gccgg c cug g  cc  aga ccuu  accuguga    gg c
    ||||| | ||| |  ||  ||| ||||  ||||||||    ||  
3'  cggcc g ggu c  gg  ucu ggag  uggacacu    cc g
   c     u c   c ga  gu   u    --        ggga  u
Get sequence
Deep sequencing
209281 reads, 2.49e+03 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 58267247-58267332 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-125a
bta-mir-99bchr18: 58266580-58266649 [+]
bta-let-7echr18: 58266748-58266826 [+]
bta-mir-125achr18: 58267247-58267332 [+]
Database links

Mature sequence bta-miR-125a

Accession MIMAT0003538
Sequence

15 -  

ucccugagacccuuuaaccugug

 - 37

Get sequence
Deep sequencing208940 reads, 78 experiments
Evidence experimental; cloned [1-2], Array [3], qRT-PCR [3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).