![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-125a |
||||||||
Accession | MI0004752 (change log) | |||||||
Description | Bos taurus miR-125a stem-loop | |||||||
Gene family | MIPF0000033; mir-10 | |||||||
Literature search |
![]()
13 open access papers mention bta-mir-125a | |||||||
Stem-loop |
u c u c uc ug c ua ---- a 5' gccgg c cug g cc aga ccuu accuguga gg c ||||| | ||| | || ||| |||| |||||||| || 3' cggcc g ggu c gg ucu ggag uggacacu cc g c u c c ga gu u -- ggga u |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence bta-miR-125a |
|
Accession | MIMAT0003538 |
Sequence |
15 - ucccugagacccuuuaaccugug - 37 |
Deep sequencing | 208940 reads, 78 experiments |
Evidence | experimental; cloned [1-2], Array [3], qRT-PCR [3] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|
3 |
PMID:19170227
"Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"
Mol Reprod Dev. 76:665-677(2009).
|