Stem-loop sequence bta-mir-128-1

AccessionMI0004755
Previous IDsbta-mir-128a;bta-mir-128
DescriptionBos taurus miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   u    u      uuc       uag      cu       u 
5'  gagc guugga   ggggccg   cacugu  gagaggu u
    |||| ||||||   |||||||   ||||||  |||||||  
3'  uucg cgacuu   cucuggc   gugaca  cucuuua a
   c    u      uuu       caa      --       c 
Get sequence
Deep sequencing
496 reads, 1.92e+03 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (UMD3.1) Overlapping transcripts
chr2: 62007752-62007833 [-]
sense
ENSBTAT00000017695 ; R3HDM1-201; intron 18
Database links

Mature sequence bta-miR-128

Accession MIMAT0003541
Previous IDsbta-miR-128a
Sequence

50 - 

ucacagugaaccggucucuuu

 - 70

Get sequence
Deep sequencing305 reads, 3 experiments
Evidence experimental; Array [2], qRT-PCR [2], cloned [3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).