Stem-loop sequence dre-mir-733

AccessionMI0004778 (change log)
DescriptionDanio rerio miR-733 stem-loop
Literature search

1 open access papers mention dre-mir-733
(1 sentences)

Stem-loop
   u   uuuu   ua   -   c  uu c        agc    u      u 
5'  ggc    ccg  gug ucg ug  g guugguuu   ucag gguuac u
    |||    |||  ||| ||| ||  | ||||||||   |||| ||||||  
3'  ccg    ggc  cac ggu ac  u caacuaaa   aguc cuagug c
   a   ---u   uc   u   -  uu c        --a    c      u 
Get sequence
Deep sequencing
553 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr14: 2406978-2407072 [-]
sense
ENSDART00000121948 ; Vault.4-201; exon 1
Database links

Mature sequence dre-miR-733

Accession MIMAT0003763
Sequence

24 - 

ugcguugguuuagcucagugguu

 - 46

Get sequence
Deep sequencing443 reads, 11 experiments
Evidence experimental; cloned [1], in-situ [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).