Stem-loop sequence dre-mir-15c

AccessionMI0004779 (change log)
DescriptionDanio rerio miR-15c stem-loop
Gene family MIPF0000006; mir-15
Literature search

4 open access papers mention dre-mir-15c
(8 sentences)

Stem-loop
          c g   a       c  c       u  aca  a 
5' ccuuaga c cua agcagcg gu augguuu ca   uu g
   ||||||| | ||| ||||||| || ||||||| ||   ||  
3' ggaauuu g gau ucgucgu ua uaccgaa gu   aa a
          u a   c       u  c       c  -gg  g 
Get sequence
Deep sequencing
14945 reads, 609 reads per million, 11 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr15: 1543686-1543768 [+]
sense
OTTDART00000025942 ; smc4-001; intron 5
ENSDART00000130413 ; smc4-001; intron 5
ENSDART00000056765 ; smc4-201; intron 5
Clustered miRNAs
< 10kb from dre-mir-15c
dre-mir-15cchr15: 1543686-1543768 [+]
dre-mir-16achr15: 1543857-1543943 [+]
Database links

Mature sequence dre-miR-15c

Accession MIMAT0003764
Sequence

14 - 

aagcagcgcgucaugguuuuc

 - 34

Get sequence
Deep sequencing14896 reads, 11 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).