Stem-loop sequence dre-mir-736

AccessionMI0004782 (change log)
DescriptionDanio rerio miR-736 stem-loop
Gene family MIPF0000178; mir-208
Literature search

1 open access papers mention dre-mir-736
(1 sentences)

Stem-loop
   u                           g        au 
5'  cuacugacagagaagcuuuuuguuugu uuauguuu  u
    ||||||||||||||||||||||||||| ||||||||   
3'  gaugauugucuuuuugaaaaacaagca aauguaaa  u
   g                           g        cu 
Get sequence
Deep sequencing
287 reads, 6.67e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 24261217-24261296 [-]
sense
OTTDART00000024215 ; vmhc-001; intron 29
ENSDART00000099532 ; vmhc-001; intron 29
Database links

Mature sequence dre-miR-736

Accession MIMAT0003767
Sequence

48 - 

guaagacgaacaaaaaguuuu

 - 68

Get sequence
Deep sequencing267 reads, 4 experiments
Evidence experimental; Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).