Stem-loop sequence xtr-let-7b

AccessionMI0004787
DescriptionXenopus tropicalis let-7b stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF0000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        u               g      -----gg      ug 
5' cuggc gagguaguaguuugu uaguua       gggcag  g
   ||||| ||||||||||||||| ||||||       ||||||   
3' gaccg uuccgucaucaaaca aucaau       cccguu  u
        -               g      agaggua      ug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172654.1: 2563148-2563229 [+]
intergenic

Mature sequence xtr-let-7b

Accession MIMAT0003550
Sequence

6 - 

ugagguaguaguuuguguaguu

 - 27

Get sequence
Evidence by similarity; MI0000063
Predicted targets