Stem-loop sequence xtr-let-7b

AccessionMI0004787 (change log)
DescriptionXenopus tropicalis let-7b stem-loop
Gene family MIPF0000002; let-7
Stem-loop
        u               g      -----gg      ug 
5' cuggc gagguaguaguuugu uaguua       gggcag  g
   ||||| ||||||||||||||| ||||||       ||||||   
3' gaccg uuccgucaucaaaca aucaau       cccguu  u
        -               g      agaggua      ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 74186422-74186503 [+]
intergenic
Database links

Mature sequence xtr-let-7b

Accession MIMAT0003550
Sequence

6 - 

ugagguaguaguuuguguaguu

 - 27

Get sequence
Evidence by similarity; MI0000063
Predicted targets