Stem-loop sequence xtr-mir-1a-2

AccessionMI0004788 (change log)
DescriptionXenopus tropicalis miR-1a-2 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   u    g                g      ----   a 
5'  ggga acauacuucuuuauau uccaua    ugg a
    |||| |||||||||||||||| ||||||    ||| g
3'  cucu uguaugaagaaaugua agguau    acc u
   -    a                -      cgua   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
KV460667.1: 104668-104738 [-]
intergenic
Database links

Mature sequence xtr-miR-1a

Accession MIMAT0003551
Sequence

47 - 

uggaauguaaagaaguaugua

 - 67

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1