Stem-loop sequence xtr-mir-1a-1

AccessionMI0004789 (change log)
DescriptionXenopus tropicalis miR-1a-1 stem-loop
Gene family MIPF0000038; mir-1
   a    uuu                     ac     ugaaca 
5'  ccug   ggaguacauacuucuuuaugu  ccaua      u
    ||||   |||||||||||||||||||||  |||||       
3'  ggac   uuuuauguaugaagaaaugua  gguau      a
   -    uau                     -a     cguaac 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr6: 93553281-93553364 [-]
ENSXETT00000006826 ; mib1-202; intron 12
ENSXETT00000016385 ; mib1-201; intron 13
Clustered miRNAs
< 10kb from xtr-mir-1a-1
xtr-mir-1a-1chr6: 93553281-93553364 [-]
xtr-mir-133achr6: 93550858-93550943 [-]
Database links

Mature sequence xtr-miR-1a

Accession MIMAT0003551

53 - 


 - 73

Get sequence
Evidence experimental; Northern [1]
Predicted targets
