Stem-loop sequence xtr-mir-1a-1

AccessionMI0004789 (change log)
DescriptionXenopus tropicalis miR-1a-1 stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
   a    uuu                     ac     ugaaca 
5'  ccug   ggaguacauacuucuuuaugu  ccaua      u
    ||||   |||||||||||||||||||||  |||||       
3'  ggac   uuuuauguaugaagaaaugua  gguau      a
   -    uau                     -a     cguaac 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr6: 93553281-93553364 [-]
ENSXETT00000006826 ; mib1-202; intron 12
ENSXETT00000016385 ; mib1-201; intron 13
Clustered miRNAs
< 10kb from xtr-mir-1a-1
xtr-mir-1a-1chr6: 93553281-93553364 [-]
xtr-mir-133achr6: 93550858-93550943 [-]
Database links

Mature sequence xtr-miR-1a

Accession MIMAT0003551

53 - 


 - 73

Get sequence
Evidence experimental; Northern [1]
Predicted targets
