Stem-loop sequence xtr-mir-7-1

AccessionMI0004790 (change log)
DescriptionXenopus tropicalis miR-7-1 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   --    u  -      a  u        a     a       u      uuuagau 
5'   ugga gu ugguuu gu cugugugg agacu gugauuu guuguu       a
     |||| || |||||| || |||||||| ||||| ||||||| ||||||        
3'   aucu cg accaga ca gguauacc ucuga cgcuaaa caacag       a
   ac    c  u      -  c        g     -       -      uuacaac 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 122025378-122025485 [-]
sense
ENSXETT00000025646 ; hnrnpk-201; intron 16
Database links

Mature sequence xtr-miR-7

Accession MIMAT0003552
Sequence

23 - 

uggaagacuagugauuuuguug

 - 44

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1