Stem-loop sequence xtr-mir-7-3

AccessionMI0004791 (change log)
DescriptionXenopus tropicalis miR-7-3 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   --     u   uu    a     g      u       -uu    a 
5'   cuggg cgg  ugga gacua ugauuu guuguuu   auaa a
     ||||| |||  |||| ||||| |||||| |||||||   ||||  
3'   gaccc guc  accu cugau gcuaaa cgacaaa   uguu g
   ag     c   uc    -     -      -       cac    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr8: 111833876-111833963 [+]
intergenic
Database links

Mature sequence xtr-miR-7

Accession MIMAT0003552
Sequence

12 - 

uggaagacuagugauuuuguug

 - 33

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1