Stem-loop sequence xtr-mir-7-2

AccessionMI0004792 (change log)
DescriptionXenopus tropicalis miR-7-2 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   ga    cag    -a u  u  u  a     a       u     --     gc 
5'   ggug   gcug  c cu ug gg agacu gugauuu guugu  uguaa  c
     ||||   ||||  | || || || ||||| ||||||| |||||  |||||   
3'   cuau   cgac  g ga ac cc ucuga cacugaa caaca  acguu  u
   -a    -aa    cc u  c  u  g     -       -     gu     au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 100078440-100078542 [-]
sense
ENSXETT00000016519 ; aen-201; intron 1
Database links

Mature sequence xtr-miR-7

Accession MIMAT0003552
Sequence

22 - 

uggaagacuagugauuuuguug

 - 43

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1