Stem-loop sequence xtr-mir-9a-1

AccessionMI0004793
DescriptionXenopus tropicalis miR-9a-1 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -       guug   uc               g      u uug 
5'  gggguug    uua  uuugguuaucuagcu uaugag g   u
    |||||||    |||  ||||||||||||||| |||||| |    
3'  ccccaau    aau  aagccaauagaucga auacuu c   c
   a       -aaa   ga               a      c uaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173063.1: 12032-12119 [+]
intergenic

Mature sequence xtr-miR-9a-5p

Accession MIMAT0003553
Previous IDsxtr-miR-9a
Sequence

15 - 

ucuuugguuaucuagcuguauga

 - 37

Get sequence
Evidence experimental; Northern [1]
Predicted targets

Mature sequence xtr-miR-9a-3p

Accession MIMAT0003554
Previous IDsxtr-miR-9a*
Sequence

55 - 

uaaagcuagauaaccgaaagu

 - 75

Get sequence
Evidence experimental; Northern [1]

References

1