Stem-loop sequence xtr-mir-9a-1

AccessionMI0004793 (change log)
DescriptionXenopus tropicalis miR-9a-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention xtr-mir-9a-1
(1 sentences)

Stem-loop
   -       guug   uc               g      u uug 
5'  gggguug    uua  uuugguuaucuagcu uaugag g   u
    |||||||    |||  ||||||||||||||| |||||| |    
3'  ccccaau    aau  aagccaauagaucga auacuu c   c
   a       -aaa   ga               a      c uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr8: 111349795-111349882 [+]
intergenic
Database links

Mature sequence xtr-miR-9a-5p

Accession MIMAT0003553
Previous IDsxtr-miR-9a
Sequence

15 - 

ucuuugguuaucuagcuguauga

 - 37

Get sequence
Evidence experimental; Northern [1]
Predicted targets

Mature sequence xtr-miR-9a-3p

Accession MIMAT0003554
Previous IDsxtr-miR-9a*
Sequence

55 - 

uaaagcuagauaaccgaaagu

 - 75

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1