Stem-loop sequence xtr-mir-9a-2

AccessionMI0004794
DescriptionXenopus tropicalis miR-9a-2 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   g    ug   g   uc               g      ugua 
5'  gaag  guu uua  uuugguuaucuagcu uaugag    u
    ||||  ||| |||  ||||||||||||||| ||||||     
3'  cuuc  caa aau  aagccaauagaucga auacuu    u
   -    cu   a   ga               a      uugg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172712.1: 2624673-2624757 [-]
intergenic

Mature sequence xtr-miR-9a-5p

Accession MIMAT0003553
Previous IDsxtr-miR-9a
Sequence

15 - 

ucuuugguuaucuagcuguauga

 - 37

Get sequence
Evidence experimental; Northern [1]
Predicted targets

Mature sequence xtr-miR-9a-3p

Accession MIMAT0003554
Previous IDsxtr-miR-9a*
Sequence

53 - 

uaaagcuagauaaccgaaagu

 - 73

Get sequence
Evidence experimental; Northern [1]

References

1