Stem-loop sequence xtr-mir-9a-2

AccessionMI0004794 (change log)
DescriptionXenopus tropicalis miR-9a-2 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention xtr-mir-9a-2
(1 sentences)

Stem-loop
   g    ug   g   uc               g      ugua 
5'  gaag  guu uua  uuugguuaucuagcu uaugag    u
    ||||  ||| |||  ||||||||||||||| ||||||     
3'  cuuc  caa aau  aagccaauagaucga auacuu    u
   -    cu   a   ga               a      uugg 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 170225657-170225741 [-]
intergenic
Database links

Mature sequence xtr-miR-9a-5p

Accession MIMAT0003553
Previous IDsxtr-miR-9a
Sequence

15 - 

ucuuugguuaucuagcuguauga

 - 37

Get sequence
Evidence experimental; Northern [1]
Predicted targets

Mature sequence xtr-miR-9a-3p

Accession MIMAT0003554
Previous IDsxtr-miR-9a*
Sequence

53 - 

uaaagcuagauaaccgaaagu

 - 73

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1