Stem-loop sequence xtr-mir-9b

AccessionMI0004795 (change log)
DescriptionXenopus tropicalis miR-9b stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention xtr-mir-9b
(1 sentences)

Stem-loop
   --    c  uc       ac      g     g   a 
5'   guuu ug  uuugguu  cuagcu uauga uau a
     |||| ||  |||||||  |||||| ||||| ||| c
3'   caaa au  aagccaa  gaucga auacu gua u
   ac    u  gc       ca      a     -   a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 102034631-102034704 [+]
intergenic
Database links

Mature sequence xtr-miR-9b-5p

Accession MIMAT0003555
Previous IDsxtr-miR-9b
Sequence

8 - 

ucuuugguuaccuagcuguauga

 - 30

Get sequence
Evidence by similarity; MI0001883
Predicted targets

Mature sequence xtr-miR-9b-3p

Accession MIMAT0003556
Previous IDsxtr-miR-9b*
Sequence

46 - 

uaaagcuagacaaccgaacgu

 - 66

Get sequence
Evidence by similarity; MI0001883
Predicted targets