Stem-loop sequence xtr-mir-9b

AccessionMI0004795
DescriptionXenopus tropicalis miR-9b stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --    c  uc       ac      g     g   a 
5'   guuu ug  uuugguu  cuagcu uauga uau a
     |||| ||  |||||||  |||||| ||||| ||| c
3'   caaa au  aagccaa  gaucga auacu gua u
   ac    u  gc       ca      a     -   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172838.1: 815867-815940 [-]
intergenic

Mature sequence xtr-miR-9b-5p

Accession MIMAT0003555
Previous IDsxtr-miR-9b
Sequence

8 - 

ucuuugguuaccuagcuguauga

 - 30

Get sequence
Evidence by similarity; MI0001883
Predicted targets

Mature sequence xtr-miR-9b-3p

Accession MIMAT0003556
Previous IDsxtr-miR-9b*
Sequence

46 - 

uaaagcuagacaaccgaacgu

 - 66

Get sequence
Evidence by similarity; MI0001883