Stem-loop sequence xtr-mir-10a

AccessionMI0004796
DescriptionXenopus tropicalis miR-10a stem-loop
Gene family MIPF0000033; mir-10
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-10_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-10 microRNA precursor is a short non-coding RNA gene involved in gene regulation. It is part of an RNA gene family which contains miR-10, miR-51, miR-57, miR-99 and miR-100. miR-10, miR-99 and miR-100 have now been predicted or experimentally confirmed in a wide range of species. (MIPF0000033, MIPF0000025) mir-51 and mir-57 have currently only been identified in the nematode Caenorhabditis elegans (MIPF0000268, MIPF0000271). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ga    cc    cu        a    g    uc          ---   gc 
5'   uuug  uguc  cuguaugu cccu uaga  cgaauuugug   uga  g
     ||||  ||||  |||||||| |||| ||||  ||||||||||   |||   
3'   aaac  acag  gacguaua gggg gucu  gcuuaaacac   acu  c
   gc    --    uu        -    g    gu          uau   aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172970.1: 535111-535210 [-]
intergenic

Mature sequence xtr-miR-10a

Accession MIMAT0003557
Sequence

22 - 

uacccuguagauccgaauuugug

 - 44

Get sequence
Evidence by similarity; MI0000841
Predicted targets