Stem-loop sequence xtr-mir-10c

AccessionMI0004798 (change log)
DescriptionXenopus tropicalis miR-10c stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   --       a    g    au          ugagu 
5'   uauaugc cccu uaga  cgaauuugug     u
     ||||||| |||| ||||  ||||||||||      
3'   guauaug gggg aucu  gcuuagacac     c
   gg       -    g    cu          caagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 142821730-142821800 [-]
intergenic
Database links

Mature sequence xtr-miR-10c

Accession MIMAT0003559
Sequence

7 - 

cacccuguagaaucgaauuugu

 - 28

Get sequence
Evidence by similarity; MI0000267
Predicted targets