Stem-loop sequence xtr-mir-15a

AccessionMI0004799 (change log)
DescriptionXenopus tropicalis miR-15a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
        acguaaa ua        ua          gg  a 
5' ccuug       g  gcagcaca  augguuugug  uu c
   |||||       |  ||||||||  ||||||||||  || a
3' ggaac       c  cgucgugu  uaccggacgu  ag c
        acaaaac gc        ca          gg  a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 146575525-146575607 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-15a
xtr-mir-15achr2: 146575525-146575607 [-]
xtr-mir-16achr2: 146575390-146575471 [-]
Database links

Mature sequence xtr-miR-15a

Accession MIMAT0003560
Sequence

14 - 

uagcagcacauaaugguuugug

 - 35

Get sequence
Evidence by similarity; MI0000069
Predicted targets