Stem-loop sequence xtr-mir-15b

AccessionMI0004800 (change log)
DescriptionXenopus tropicalis miR-15b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   ug      agaa   u       c uc      ugcaug      
5'   uccuaa    gug agcagca a  augauu      cugua 
     ||||||    ||| ||||||| |  ||||||      |||| u
3'   aggguu    uac ucgucgu u  uacuaa      gauau 
   aa      auag   u       u uu      -ucuua      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr5: 103362195-103362282 [-]
sense
ENSXETT00000019103 ; smc4-201; intron 5
Clustered miRNAs
< 10kb from xtr-mir-15b
xtr-mir-15bchr5: 103362195-103362282 [-]
xtr-mir-16bchr5: 103362038-103362121 [-]
Database links

Mature sequence xtr-miR-15b

Accession MIMAT0003561
Sequence

16 - 

uagcagcacaucaugauuugca

 - 37

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1