Stem-loop sequence xtr-mir-16c

AccessionMI0004801
DescriptionXenopus tropicalis miR-16c stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --uu        -c    a        -uucau  c 
5'     uagcagca  guaa uacuggag      ga c
       ||||||||  |||| ||||||||      || a
3'     aucgucgu  cauu augaccuc      cu u
   uuau        uu    -        ucacgu  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172667.1: 1164907-1164976 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-16c
xtr-mir-15cGL172667.1: 1166902-1166975 [-]
xtr-mir-16cGL172667.1: 1164907-1164976 [-]

Mature sequence xtr-miR-16c

Accession MIMAT0003562
Sequence

3 - 

uagcagcacguaaauacuggag

 - 24

Get sequence
Evidence by similarity; MI0001895
Predicted targets