Stem-loop sequence xtr-mir-16a

AccessionMI0004802
DescriptionXenopus tropicalis miR-16a stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --      ag c            -  a        ug  a 
5'   gccagc  u cuuuagcagcac gu aauauugg  uu a
     ||||||  | |||||||||||| || ||||||||  || a
3'   cgguug  a gagaucgucgug ca uuauaacc  gg a
   uc      ga u            u  a        cu  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172803.1: 1671283-1671364 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-16a
xtr-mir-15aGL172803.1: 1671418-1671500 [-]
xtr-mir-16aGL172803.1: 1671283-1671364 [-]

Mature sequence xtr-miR-16a

Accession MIMAT0003563
Sequence

14 - 

uagcagcacguaaauauuggug

 - 35

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1