Stem-loop sequence xtr-mir-17

AccessionMI0004803 (change log)
DescriptionXenopus tropicalis miR-17 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
        ga       -ca        a  g     g   u a   a 
5' gucaa  guaaugu   aagugcuu ca ugcag uag g uuu a
   |||||  |||||||   |||||||| || ||||| ||| | |||  
3' caguu  uauuacg   uucacgga gu acguc auc c aag c
        -a       aug        a  g     -   - -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 120020382-120020468 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-17
xtr-mir-17chr2: 120020382-120020468 [-]
xtr-mir-18achr2: 120020254-120020340 [-]
xtr-mir-19achr2: 120020112-120020192 [-]
xtr-mir-20achr2: 120019984-120020067 [-]
xtr-mir-19b-2chr2: 120019859-120019937 [-]
xtr-mir-92a-1chr2: 120019740-120019817 [-]
Database links

Mature sequence xtr-miR-17-5p

Accession MIMAT0003564
Sequence

15 - 

caaagugcuuacagugcagguagu

 - 38

Get sequence
Evidence experimental; Northern [1]
Predicted targets

Mature sequence xtr-miR-17-3p

Accession MIMAT0003565
Sequence

54 - 

acugcagugaaggcacuugu

 - 73

Get sequence
Evidence by similarity; MI0000071
Predicted targets

References

1