Stem-loop sequence xtr-mir-17

Accession MI0004803
Description Xenopus tropicalis miR-17 stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     ga       -ca        a  g     g   u a   a 
gucaa  guaaugu   aagugcuu ca ugcag uag g uuu a
|||||  |||||||   |||||||| || ||||| ||| | |||  
caguu  uauuacg   uucacgga gu acguc auc c aag c
     -a       aug        a  g     -   - -   a 
Get sequence
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173376.1: 85797-85883 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-17
xtr-mir-17 GL173376.1: 85797-85883 [-]
xtr-mir-18a GL173376.1: 85669-85755 [-]
xtr-mir-19a GL173376.1: 85527-85607 [-]
xtr-mir-20a GL173376.1: 85399-85482 [-]
xtr-mir-19b-2 GL173376.1: 85274-85352 [-]
xtr-mir-92a-1 GL173376.1: 85155-85232 [-]

Mature sequence xtr-miR-17-5p

Accession MIMAT0003564
Sequence

15 - 

caaagugcuuacagugcagguagu

 - 38

Get sequence
Evidence experimental; Northern [1]
Predicted targets

Mature sequence xtr-miR-17-3p

Accession MIMAT0003565
Sequence

54 - 

acugcagugaaggcacuugu

 - 73

Get sequence
Evidence by similarity; MI0000071
Predicted targets

References

1