Stem-loop sequence xtr-mir-19a

AccessionMI0004804 (change log)
DescriptionXenopus tropicalis miR-19a stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
   g   u  u                 --      ---    ag 
5'  cag cu cuguuaguuuugcauag  uugcac   uaca  a
    ||| || |||||||||||||||||  ||||||   ||||  a
3'  guc ga gguagucaaaacguauc  aacgug   augu  a
   -   c  c                 ua      uug    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 120020112-120020192 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-19a
xtr-mir-17chr2: 120020382-120020468 [-]
xtr-mir-18achr2: 120020254-120020340 [-]
xtr-mir-19achr2: 120020112-120020192 [-]
xtr-mir-20achr2: 120019984-120020067 [-]
xtr-mir-19b-2chr2: 120019859-120019937 [-]
xtr-mir-92a-1chr2: 120019740-120019817 [-]
Database links

Mature sequence xtr-miR-19a

Accession MIMAT0003566
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Evidence by similarity; MI0000073
Predicted targets