Stem-loop sequence xtr-mir-19b-2

AccessionMI0004805 (change log)
DescriptionXenopus tropicalis miR-19b-2 stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
   -u                 -  -       ------    uug 
5'   ucaugguuaguuuugca gg uuugcau      ccag   u
     ||||||||||||||||| || |||||||      ||||    
3'   gguauuagucaaaacgu cc aaacgug      gguc   u
   ac                 a  u       ucacuc    uuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 120019859-120019937 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-19b-2
xtr-mir-17chr2: 120020382-120020468 [-]
xtr-mir-18achr2: 120020254-120020340 [-]
xtr-mir-19achr2: 120020112-120020192 [-]
xtr-mir-20achr2: 120019984-120020067 [-]
xtr-mir-19b-2chr2: 120019859-120019937 [-]
xtr-mir-92a-1chr2: 120019740-120019817 [-]
Database links

Mature sequence xtr-miR-19b

Accession MIMAT0003567
Sequence

49 - 

ugugcaaauccaugcaaaacuga

 - 71

Get sequence
Evidence by similarity; MI0001452
Predicted targets