Stem-loop sequence xtr-mir-19b-2

AccessionMI0004805
DescriptionXenopus tropicalis miR-19b-2 stem-loop
Gene family MIPF0000011; mir-19
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-19_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

There are 89 known sequences today in the microRNA 19 (miR-19) family but it will change quickly. They are found in a large number of vertebrate species. The miR-19 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. Within the human and mouse genome there are three copies of this microRNA that are processed from multiple predicted precursor hairpins: mouse: * miR-19a on chromosome 14 (MI0000688) * miR-19b-1 on chromosome 14 (MI0000718) * miR-19b-2 on chromosome X (MI0000546) human: * miR-19a on chromosome 13 (MI0000073) * miR-19b-1 on chromosome 13 (MI0000074) * miR-19b-2 on chromosome X (MI000075). MiR-19 has now been predicted or experimentally confirmed (MIPF0000011). In this case the mature sequence is excised from the 3' arm of the hairpin precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -u                 -  -       ------    uug 
5'   ucaugguuaguuuugca gg uuugcau      ccag   u
     ||||||||||||||||| || |||||||      ||||    
3'   gguauuagucaaaacgu cc aaacgug      gguc   u
   ac                 a  u       ucacuc    uuc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173376.1: 85274-85352 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-19b-2
xtr-mir-17GL173376.1: 85797-85883 [-]
xtr-mir-18aGL173376.1: 85669-85755 [-]
xtr-mir-19aGL173376.1: 85527-85607 [-]
xtr-mir-20aGL173376.1: 85399-85482 [-]
xtr-mir-19b-2GL173376.1: 85274-85352 [-]
xtr-mir-92a-1GL173376.1: 85155-85232 [-]

Mature sequence xtr-miR-19b

Accession MIMAT0003567
Sequence

49 - 

ugugcaaauccaugcaaaacuga

 - 71

Get sequence
Evidence by similarity; MI0001452
Predicted targets