Stem-loop sequence xtr-mir-23a-2

AccessionMI0004806
DescriptionXenopus tropicalis miR-23a-2 stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   cu u       a   --          a       ggaaa      
5'   g ggcuggu gga  uuccuggcag gugauuu     uguau 
     | ||||||| |||  |||||||||| |||||||     |||| g
3'   c cugacua ccu  agggaccguu cacuaaa     acaug 
   -g c       a   uu          a       -----      
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172640.1: 579916-579998 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-23a-2
xtr-mir-23a-2GL172640.1: 579916-579998 [+]
xtr-mir-27c-1GL172640.1: 580205-580286 [+]
xtr-mir-27c-2GL172640.1: 587849-587930 [+]

Mature sequence xtr-miR-23a

Accession MIMAT0003568
Sequence

52 - 

aucacauugccagggauuucc

 - 72

Get sequence
Evidence by similarity; MI0000571
Predicted targets