Stem-loop sequence xtr-mir-26-1

AccessionMI0004807
DescriptionXenopus tropicalis miR-26-1 stem-loop
Gene family MIPF0000043; mir-26
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-26_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
          g     uu         c  ga        uucc 
5' ggcugcu ccugg  caaguaauc ag  uaggcugu    u
   ||||||| |||||  ||||||||| ||  ||||||||    c
3' ucgauga ggacu  guucauuag uc  auccggca    a
          a     uu         u  uc        cgaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172703.1: 1413593-1413677 [-]
sense
ENSXETT00000021239 ; ctdsp2-202; intron 5
ENSXETT00000060148 ; ctdsp2-201; intron 5

Mature sequence xtr-miR-26

Accession MIMAT0003569
Sequence

14 - 

uucaaguaauccaggauaggc

 - 34

Get sequence
Evidence by similarity; MI0000750
Predicted targets