Stem-loop sequence xtr-mir-26-2

AccessionMI0004808 (change log)
DescriptionXenopus tropicalis miR-26-2 stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
   ug   g  c cu          c    u      uaaug 
5'   ggc cu g  ucaaguaauc agga aggcug     u
     ||| || |  |||||||||| |||| ||||||     c
3'   ccg ga c  gguucauuag ucuu uccgac     u
   -a   a  c ag          c    u      ugucc 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr9: 77064693-77064772 [+]
sense
ENSXETT00000032705 ; ctdsp1-201; intron 4
chr9: 77070809-77070888 [+]
sense
ENSXETT00000032705 ; ctdsp1-201; intron 4
Database links

Mature sequence xtr-miR-26

Accession MIMAT0003569
Sequence

12 - 

uucaaguaauccaggauaggc

 - 32

Get sequence
Evidence by similarity; MI0000750
Predicted targets