Stem-loop sequence xtr-mir-27a

AccessionMI0004809
DescriptionXenopus tropicalis miR-27a stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -c    g cca          gu          -c   ca 
5'   ggcg c   gggcuuagcu  auugugagca  ugu  c
     |||| |   ||||||||||  ||||||||||  |||  u
3'   ccgc g   cuugaaucgg  ugacacuugu  acg  c
   cu    - --c          --          cc   cu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173333.1: 483573-483648 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-27a
xtr-mir-23a-1GL173333.1: 484179-484256 [-]
xtr-mir-27aGL173333.1: 483573-483648 [-]
xtr-mir-24bGL173333.1: 483445-483512 [-]

Mature sequence xtr-miR-27a

Accession MIMAT0003570
Sequence

51 - 

uucacaguggcuaaguuccgc

 - 71

Get sequence
Evidence by similarity; MI0000085
Predicted targets