Stem-loop sequence xtr-mir-27a

AccessionMI0004809 (change log)
DescriptionXenopus tropicalis miR-27a stem-loop
Gene family MIPF0000036; mir-27
Stem-loop
   -c    g cca          gu          -c   ca 
5'   ggcg c   gggcuuagcu  auugugagca  ugu  c
     |||| |   ||||||||||  ||||||||||  |||  u
3'   ccgc g   cuugaaucgg  ugacacuugu  acg  c
   cu    - --c          --          cc   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 129999278-129999353 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-27a
xtr-mir-23a-1chr3: 129998670-129998747 [+]
xtr-mir-27achr3: 129999278-129999353 [+]
xtr-mir-24bchr3: 129999414-129999481 [+]
Database links

Mature sequence xtr-miR-27a

Accession MIMAT0003570
Sequence

51 - 

uucacaguggcuaaguuccgc

 - 71

Get sequence
Evidence by similarity; MI0000085
Predicted targets