Stem-loop sequence xtr-mir-27b

AccessionMI0004810 (change log)
DescriptionXenopus tropicalis miR-27b stem-loop
Gene family MIPF0000036; mir-27
Stem-loop
   -a       acca                  auug        u  uug 
5'   ccuuucu    aggugcagagcuuagcug    gugaacag ga   a
     |||||||    ||||||||||||||||||    |||||||| ||   u
3'   ggagaga    uccacgucuugaaucggu    cacuuguu cu   u
   cg       --ag                  --ga        u  ccc 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 123463698-123463793 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-27b
xtr-mir-23bchr1: 123463474-123463561 [+]
xtr-mir-27bchr1: 123463698-123463793 [+]
xtr-mir-24achr1: 123464315-123464381 [+]
Database links

Mature sequence xtr-miR-27b

Accession MIMAT0003571
Sequence

61 - 

uucacaguggcuaaguucugc

 - 81

Get sequence
Evidence by similarity; MI0000440
Predicted targets