Stem-loop sequence xtr-mir-27b

AccessionMI0004810
DescriptionXenopus tropicalis miR-27b stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -a       acca                  auug        u  uug 
5'   ccuuucu    aggugcagagcuuagcug    gugaacag ga   a
     |||||||    ||||||||||||||||||    |||||||| ||   u
3'   ggagaga    uccacgucuugaaucggu    cacuuguu cu   u
   cg       --ag                  --ga        u  ccc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172758.1: 2024474-2024569 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-27b
xtr-mir-23bGL172758.1: 2024250-2024337 [+]
xtr-mir-27bGL172758.1: 2024474-2024569 [+]
xtr-mir-24aGL172758.1: 2025091-2025157 [+]

Mature sequence xtr-miR-27b

Accession MIMAT0003571
Sequence

61 - 

uucacaguggcuaaguucugc

 - 81

Get sequence
Evidence by similarity; MI0000440
Predicted targets