Stem-loop sequence xtr-mir-29d

AccessionMI0004811
DescriptionXenopus tropicalis miR-29d stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uc    g                 gu      uuaac 
5'   agga gcugguuucauguggug  uuagau     u
     |||| |||||||||||||||||  ||||||     g
3'   uccu ugacuaaaguauaccac  gaucug     c
   au    g                 --      uaaca 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172647.1: 3186647-3186721 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-29d
xtr-mir-29dGL172647.1: 3186647-3186721 [+]
xtr-mir-29aGL172647.1: 3189302-3189388 [+]

Mature sequence xtr-miR-29d

Accession MIMAT0003572
Sequence

49 - 

uagcaccauaugaaaucaguguc

 - 71

Get sequence
Evidence by similarity; MI0000105
Predicted targets