Stem-loop sequence xtr-mir-29b

AccessionMI0004812 (change log)
DescriptionXenopus tropicalis miR-29b stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   -   cg   -         uu      a  u    u  ucc 
5'  ucc  gaa gcugguuuc  guggug cu agau ua   a
    |||  ||| |||||||||  |||||| || |||| ||    
3'  agg  cuu ugacuaaag  uaccac ga ucua gu   u
   g   au   g         uu      -  -    c  cgc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 48073401-48073480 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-29b
xtr-mir-29bchr2: 48073401-48073480 [+]
xtr-mir-29cchr2: 48076534-48076623 [+]
Database links

Mature sequence xtr-miR-29b

Accession MIMAT0003573
Sequence

51 - 

uagcaccauuugaaaucaguguu

 - 73

Get sequence
Evidence by similarity; MI0000107
Predicted targets