Stem-loop sequence xtr-mir-30a

AccessionMI0004813 (change log)
DescriptionXenopus tropicalis miR-30a stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
      a           cuc           g gaag 
5' gcg cuguaaacauc   gacuggaagcu u    c
   ||| |||||||||||   ||||||||||| |    a
3' cgu gacguuuguag   cugacuuucgg a    g
      c           --a           g aguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr5: 91687780-91687850 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-30a
xtr-mir-30achr5: 91687780-91687850 [-]
xtr-mir-30c-2chr5: 91680390-91680467 [-]
Database links

Mature sequence xtr-miR-30a-5p

Accession MIMAT0003574
Sequence

6 - 

uguaaacauccucgacuggaag

 - 27

Get sequence
Evidence by similarity; MI0000088
Predicted targets

Mature sequence xtr-miR-30a-3p

Accession MIMAT0003575
Sequence

47 - 

cuuucagucagauguuugcagc

 - 68

Get sequence
Evidence by similarity; MI0000088
Predicted targets