Stem-loop sequence xtr-mir-30a

AccessionMI0004813
DescriptionXenopus tropicalis miR-30a stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      a           cuc           g gaag 
5' gcg cuguaaacauc   gacuggaagcu u    c
   ||| |||||||||||   ||||||||||| |    a
3' cgu gacguuuguag   cugacuuucgg a    g
      c           --a           g aguu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172904.1: 1391566-1391636 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-30a
xtr-mir-30aGL172904.1: 1391566-1391636 [+]
xtr-mir-30c-2GL172904.1: 1398963-1399040 [+]

Mature sequence xtr-miR-30a-5p

Accession MIMAT0003574
Sequence

6 - 

uguaaacauccucgacuggaag

 - 27

Get sequence
Evidence by similarity; MI0000088
Predicted targets

Mature sequence xtr-miR-30a-3p

Accession MIMAT0003575
Sequence

47 - 

cuuucagucagauguuugcagc

 - 68

Get sequence
Evidence by similarity; MI0000088
Predicted targets