Stem-loop sequence xtr-mir-30b

AccessionMI0004814
DescriptionXenopus tropicalis miR-30b stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   gu       uau          ua       c   uaug 
5'   auuaguc   guaaacaucc  cacucag ucg    u
     |||||||   ||||||||||  ||||||| |||    a
3'   uagucag   cguuuguggg  guggguc agu    u
   uc       cuc          gg       -   ccaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172657.1: 3195539-3195618 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-30b
xtr-mir-30dGL172657.1: 3199783-3199863 [-]
xtr-mir-30bGL172657.1: 3195539-3195618 [-]

Mature sequence xtr-miR-30b

Accession MIMAT0003576
Sequence

12 - 

uguaaacauccuacacucagcu

 - 33

Get sequence
Evidence by similarity; MI0001941
Predicted targets