Stem-loop sequence xtr-mir-30b

AccessionMI0004814 (change log)
DescriptionXenopus tropicalis miR-30b stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   gu       uau          ua       c   uaug 
5'   auuaguc   guaaacaucc  cacucag ucg    u
     |||||||   ||||||||||  ||||||| |||    a
3'   uagucag   cguuuguggg  guggguc agu    u
   uc       cuc          gg       -   ccaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr6: 126125374-126125453 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-30b
xtr-mir-30dchr6: 126121129-126121209 [+]
xtr-mir-30bchr6: 126125374-126125453 [+]
Database links

Mature sequence xtr-miR-30b

Accession MIMAT0003576
Sequence

12 - 

uguaaacauccuacacucagcu

 - 33

Get sequence
Evidence by similarity; MI0001941
Predicted targets