Stem-loop sequence xtr-mir-30c-1

AccessionMI0004815 (change log)
DescriptionXenopus tropicalis miR-30c-1 stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   a     ca    u auu           aca        ug gaa 
5'  ccaug  gcag g   guaaacauccu   cucucagc  u   c
    |||||  |||| |   |||||||||||   ||||||||  |   a
3'  gguac  cguc c   cauuuguggga   gagggucg  g   u
   a     --    c ccu           --a        gu gaa 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 83742896-83742984 [+]
sense
ENSXETT00000054158 ; nfyc-201; intron 5
Clustered miRNAs
< 10kb from xtr-mir-30c-1
xtr-mir-30echr2: 83741892-83741981 [+]
xtr-mir-30c-1chr2: 83742896-83742984 [+]
Database links

Mature sequence xtr-miR-30c

Accession MIMAT0003577
Sequence

17 - 

uguaaacauccuacacucucagc

 - 39

Get sequence
Evidence by similarity; MI0000871
Predicted targets