Stem-loop sequence xtr-mir-34a

AccessionMI0004816 (change log)
DescriptionXenopus tropicalis miR-34a stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   -c    -  ug     uu        c  a            gg acg 
5'   ugug ag  uuucu  ggcagugu uu gcugguuguugu  c   u
     |||| ||  |||||  |||||||| || ||||||||||||  |    
3'   acac uc  gaaga  ccgucaua aa cgacuaacgaug  g   u
   uu    g  uu     uc        u  a            aa aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr7: 80700727-80700822 [-]
intergenic
Database links

Mature sequence xtr-miR-34a

Accession MIMAT0003578
Sequence

16 - 

uggcagugucuuagcugguuguu

 - 38

Get sequence
Evidence by similarity; MI0000268
Predicted targets