Stem-loop sequence xtr-mir-34b-2

AccessionMI0004817 (change log)
DescriptionXenopus tropicalis miR-34b-2 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   --uuca  c   g       c        uuaua 
5'       gg agu uaguuag ugauugug     u
         || ||| ||||||| ||||||||      
3'       cc uca aucgauc acuaacgu     c
   aaaaua  a   a       -        uuaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr7: 75059637-75059703 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-34b-2
xtr-mir-34b-1chr7: 75066349-75066433 [+]
xtr-mir-34b-2chr7: 75059637-75059703 [-]
Database links

Mature sequence xtr-miR-34b

Accession MIMAT0003579
Sequence

3 - 

caggcaguguaguuagcugauug

 - 25

Get sequence
Evidence by similarity; MI0003690
Predicted targets