Stem-loop sequence xtr-mir-34b-4

AccessionMI0004818 (change log)
DescriptionXenopus tropicalis miR-34b-4 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   --uuca  c   g       c        uuaua 
5'       gg agu uaguuag ugauugug     u
         || ||| ||||||| ||||||||      
3'       cc uca aucgauc acuaacgu     c
   aaaaua  a   a       -        uuaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence xtr-miR-34b

Accession MIMAT0003579
Sequence

3 - 

caggcaguguaguuagcugauug

 - 25

Get sequence
Evidence by similarity; MI0003690
Predicted targets