Stem-loop sequence xtr-mir-92a-2

AccessionMI0004819 (change log)
DescriptionXenopus tropicalis miR-92a-2 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
     c    ug   g     uu  u   c    guaug 
5' uc ucug  ggu gggau  gu gca uacu     u
   || ||||  ||| |||||  || ||| ||||      
3' ag gggu  ccg cccug  ca cgu auga     a
     u    gu   g     uu  -   u    aaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr8: 47197691-47197763 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-92a-2
xtr-mir-106chr8: 47198219-47198281 [-]
xtr-mir-18bchr8: 47198092-47198169 [-]
xtr-mir-20bchr8: 47197934-47198007 [-]
xtr-mir-19b-1chr8: 47197821-47197893 [-]
xtr-mir-92a-2chr8: 47197691-47197763 [-]
xtr-mir-363chr8: 47197557-47197643 [-]
Database links

Mature sequence xtr-miR-92a

Accession MIMAT0003580
Sequence

46 - 

uauugcacuugucccggccug

 - 66

Get sequence
Evidence by similarity; MI0001951
Predicted targets