Stem-loop sequence xtr-mir-98

AccessionMI0004820
DescriptionXenopus tropicalis miR-98 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF0000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uc    -cu  u    au                 u    ----------      uuu 
5'   ugcc   cu cagg  gagguaguaaguuguau guug          uggggg   u
     ||||   || ||||  ||||||||||||||||| ||||          ||||||    
3'   augg   ga gucc  uuccgucauucgacaua caau          accccu   u
   ua    uac  c    -c                 u    agaggauuaa      uua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173143.1: 538440-538547 [-]
sense
ENSXETT00000061581 ; HUWE1-201; intron 65
Clustered miRNAs
< 10kb from xtr-mir-98
xtr-let-7fGL173143.1: 538707-538789 [-]
xtr-mir-98GL173143.1: 538440-538547 [-]

Mature sequence xtr-miR-98

Accession MIMAT0003581
Sequence

17 - 

ugagguaguaaguuguauuguu

 - 38

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1