Stem-loop sequence xtr-mir-98

AccessionMI0004820 (change log)
DescriptionXenopus tropicalis miR-98 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   uc    -cu  u    au                 u    ----------      uuu 
5'   ugcc   cu cagg  gagguaguaaguuguau guug          uggggg   u
     ||||   || ||||  ||||||||||||||||| ||||          ||||||    
3'   augg   ga gucc  uuccgucauucgacaua caau          accccu   u
   ua    uac  c    -c                 u    agaggauuaa      uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr8: 8410552-8410659 [-]
sense
ENSXETT00000061581 ; HUWE1-201; intron 65
Clustered miRNAs
< 10kb from xtr-mir-98
xtr-let-7fchr8: 8410819-8410901 [-]
xtr-mir-98chr8: 8410552-8410659 [-]
Database links

Mature sequence xtr-miR-98

Accession MIMAT0003581
Sequence

17 - 

ugagguaguaaguuguauuguu

 - 38

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1